86
|
Sangon Biotech
china n a γ catenin sgrna China N A γ Catenin Sgrna, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/pm41005296-244-51-57?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
china n a γ catenin sgrna - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
94
|
Addgene inc
grna expression plasmid pu6 bbsi chirna Grna Expression Plasmid Pu6 Bbsi Chirna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/bio_rxiv__2025__10__27__684876-196-13-17?v=Addgene+inc Average 94 stars, based on 1 article reviews
grna expression plasmid pu6 bbsi chirna - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
94
|
Addgene inc
hek3 locus Hek3 Locus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/pm41219485-385-21-23?v=Addgene+inc Average 94 stars, based on 1 article reviews
hek3 locus - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
96
|
Addgene inc
crispri expression vector Crispri Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/us11214797-3250-11-23?v=Addgene+inc Average 96 stars, based on 1 article reviews
crispri expression vector - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pu6 Pu6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/luallen_robert__2016__infection_strategies_of_related_nematocida_microsporidian_species_in_their_natural_host_caenorhabditis-345-26-27?v=Addgene+inc Average 93 stars, based on 1 article reviews
pu6 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pu6 cj sgrna Pu6 Cj Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/pm40781772-195-41-44?v=Addgene+inc Average 93 stars, based on 1 article reviews
pu6 cj sgrna - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
97
|
Addgene inc
pu6 pegrna gg acceptor Pu6 Pegrna Gg Acceptor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/pmc12670555-111-16-17?v=Addgene+inc Average 97 stars, based on 1 article reviews
pu6 pegrna gg acceptor - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
96
|
Addgene inc
c ris pr ca59 plasmid C Ris Pr Ca59 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/harlow_charli_elizabeth__2022__the_role_of_common_genetic_variants_for_predicting_the_modulation_of_cardiovascular_outcomes-1553-13-11?v=Addgene+inc Average 96 stars, based on 1 article reviews
c ris pr ca59 plasmid - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pu6 sgrna ef1α puro t2a mcherry vector Pu6 Sgrna Ef1α Puro T2a Mcherry Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/bio_rxiv__64898__2025__12__29__696402-248-23-26?v=Addgene+inc Average 93 stars, based on 1 article reviews
pu6 sgrna ef1α puro t2a mcherry vector - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
backbone plasmid pu6 sggal4 Backbone Plasmid Pu6 Sggal4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/pm28787145__ja7b06555_si_001-80-1-7?v=Addgene+inc Average 93 stars, based on 1 article reviews
backbone plasmid pu6 sggal4 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
sgrna targeting acggctcataagagacttgg Sgrna Targeting Acggctcataagagacttgg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pu+6/pm33976151-545-70-83?v=Addgene+inc Average 93 stars, based on 1 article reviews
sgrna targeting acggctcataagagacttgg - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |