pu 6 Search Results


86
Sangon Biotech china n a γ catenin sgrna
China N A γ Catenin Sgrna, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/pm41005296-244-51-57?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
china n a γ catenin sgrna - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

94
Addgene inc grna expression plasmid pu6 bbsi chirna
Grna Expression Plasmid Pu6 Bbsi Chirna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/bio_rxiv__2025__10__27__684876-196-13-17?v=Addgene+inc
Average 94 stars, based on 1 article reviews
grna expression plasmid pu6 bbsi chirna - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
Addgene inc hek3 locus
Hek3 Locus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/pm41219485-385-21-23?v=Addgene+inc
Average 94 stars, based on 1 article reviews
hek3 locus - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
Addgene inc crispri expression vector
Crispri Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/us11214797-3250-11-23?v=Addgene+inc
Average 96 stars, based on 1 article reviews
crispri expression vector - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

93
Addgene inc pu6
Pu6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/luallen_robert__2016__infection_strategies_of_related_nematocida_microsporidian_species_in_their_natural_host_caenorhabditis-345-26-27?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pu6 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc pu6 cj sgrna
Pu6 Cj Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/pm40781772-195-41-44?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pu6 cj sgrna - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

97
Addgene inc pu6 pegrna gg acceptor
Pu6 Pegrna Gg Acceptor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/pmc12670555-111-16-17?v=Addgene+inc
Average 97 stars, based on 1 article reviews
pu6 pegrna gg acceptor - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

96
Addgene inc c ris pr ca59 plasmid
C Ris Pr Ca59 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/harlow_charli_elizabeth__2022__the_role_of_common_genetic_variants_for_predicting_the_modulation_of_cardiovascular_outcomes-1553-13-11?v=Addgene+inc
Average 96 stars, based on 1 article reviews
c ris pr ca59 plasmid - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

93
Addgene inc pu6 sgrna ef1α puro t2a mcherry vector
Pu6 Sgrna Ef1α Puro T2a Mcherry Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/bio_rxiv__64898__2025__12__29__696402-248-23-26?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pu6 sgrna ef1α puro t2a mcherry vector - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc backbone plasmid pu6 sggal4
Backbone Plasmid Pu6 Sggal4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/pm28787145__ja7b06555_si_001-80-1-7?v=Addgene+inc
Average 93 stars, based on 1 article reviews
backbone plasmid pu6 sggal4 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc sgrna targeting acggctcataagagacttgg
Sgrna Targeting Acggctcataagagacttgg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pu+6/pm33976151-545-70-83?v=Addgene+inc
Average 93 stars, based on 1 article reviews
sgrna targeting acggctcataagagacttgg - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results